MISSION® esiRNA

Name	MISSION® esiRNA
Supplier	Sigma-Aldrich
Catalog	EHU031251
Category	siRNA
Prices	$140.00, $250.00
Sizes	20 µg, 50 µg
Applications	Gene Silencing
Gene	CAV1
Sequence	GAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATC
Description	MISSION esiRNA are endo-ribonuclease prepared siRNA
Supplier Page	Shop

Product images

<B>Immunoblotting</B><BR/>CAV1: <B>Cat. No. EHU031251</B>: Western blot analysis of Caveolin 1 in HeLa cells.<BR/><B>Lanes</B><BR/>1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, <B>Cat. No. EHURLUC</B>) as negative control.<BR/>2. HeLa cells transfected with CAV1 esiRNA (<B>Cat. No. EHU031251</B>). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-Caveolin-1 (1:1000) Clone: CAV1 (<B>Cat. No.SAB4200216</B>) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, a 74% CAV1 protein reduction was measured between the negative control RLUC and the sample treated with CAV1 esiRNA.

Immunoblotting
CAV1: Cat. No. EHU031251: Western blot analysis of Caveolin 1 in HeLa cells.
Lanes
1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, Cat. No. EHURLUC) as negative control.
2. HeLa cells transfected with CAV1 esiRNA (Cat. No. EHU031251). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-Caveolin-1 (1:1000) Clone: CAV1 (Cat. No.SAB4200216) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, a 74% CAV1 protein reduction was measured between the negative control RLUC and the sample treated with CAV1 esiRNA.